Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250121

Morpholino Name: pou5f3.2 MO4
Synonyms: Oct-25MO, Oct25MO, oct25, oct25 mo
Target mRNA: pou5f3.2

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTTGGCTGTACATGGTGTCCAAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' TCTTGGACACCATGTACAGCCAACA 3' ||||||||||||||||||||||||| 3' AGAACCTGTGGTACATGTCGGTTGT 5' 5' CCCTCGACACCATGTACAGCCAACA 3' | | |||||||||||||||||||| 3' AGAACCTGTGGTACATGTCGGTTGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:2141736..2141760 25/25 Antisense target pou5f3.2.L
chr8S:27463661..27463685 22/25 Antisense target pou5f3.2.S
chr1S:92596431..92596455 21/25 Antisense off-target smim7.S
Publications
First: POU-V factors antagonize maternal VegT activity and beta-Catenin signaling in Xenopus embryos., EMBO J 2007  
Most recent: Negative autoregulation of Oct3/4 through Cdx1 promotes the onset of gastrulation., Dev Dyn 2011          
View All Papers