Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250122

Morpholino Name: pou5f3.3 MO1
Synonyms: Oct60MO, Oct60MOa1, oct60 MO1
mRNA Target: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence:
5' TCCATCTCCAGCACTTGCTCAGGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGCCTGAGCAAGTGCTGGAGATGGA 3' ||||||||||||||||||||||||| 3' CCGGACTCGTTCACGACCTCTACCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold37448:491978..492002 25/25 Antisense target pou5f3.3.L
Scaffold46073:2412591..2412615 23/25 Antisense off-target Xelaev16055867m
Scaffold127187:1034129..1034153 21/25 Antisense off-target Xelaev16007745m
Scaffold21603:2960202..2960226 21/25 Antisense off-target dnpep.L
tropicalis 7.1 scaffold_9:5184694..5184718 21/25 Antisense off-target dnpep
Publications
First: Xenopus POU factors of subclass V inhibit activin/nodal signaling during gastrulation., Mech Dev 2006              
Most recent: Negative autoregulation of Oct3/4 through Cdx1 promotes the onset of gastrulation., Dev Dyn 2011          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556