Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250122

Morpholino Name: pou5f3.3 MO1
Synonyms: Oct60MO, Oct60MOa1, oct60 MO1
Target mRNA: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCATCTCCAGCACTTGCTCAGGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GGCCTGAGCAAGTGCTGGAGATGGA 3' ||||||||||||||||||||||||| 3' CCGGACTCGTTCACGACCTCTACCT 5' 5' GGCCTGACCAAGTGCTGGAAATGGA 3' ||||||| ||||||||||| ||||| 3' CCGGACTCGTTCACGACCTCTACCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:2135327..2135351 25/25 Antisense target pou5f3.3.L
chr8S:27458416..27458440 23/25 Antisense target pou5f3.3.S
chr9_10L:51458835..51458859 21/25 Antisense off-target dnpep.L
chr9_10S:46784806..46784830 21/25 Antisense off-target dnpep.S
tropicalis 10.0 Chr9:83810014..83810038 21/25 Antisense off-target dnpep
Chr8:119639469..119639493 21/25 unknown
Publications
First: Xenopus POU factors of subclass V inhibit activin/nodal signaling during gastrulation., Mech Dev 2006              
Most recent: Negative autoregulation of Oct3/4 through Cdx1 promotes the onset of gastrulation., Dev Dyn 2011          
View All Papers