Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250123

Morpholino Name: pou5f3.3 MO2
Synonyms: XLPOU60 mo
mRNA Target: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCTGTACAATATGGATTGGACCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' ATGGACCAGCCCATATTGTACAGCC 3' |||| ||| ||||||||||||||| 3' TACCAGGTTAGGTATAACATGTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold46073:2412611..2412635 24/25 Antisense off-target Xelaev16055867m
Scaffold161503:3576689..3576713 22/25 unknown
Scaffold37448:491958..491982 22/25 Antisense target pou5f3.3.L
Scaffold73014:518014..518038 21/25 Antisense off-target pex3.L
tropicalis 7.1 scaffold_4:73990593..73990617 22/25 Antisense off-target nptxr
scaffold_2:79779518..79779542 21/25 Sense off-target pcdh17
Publications
First: A conserved Oct4/POUV-dependent network links adhesion and migration to progenitor maintenance., Curr Biol 2013                                      
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556