Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250123

Morpholino Name: pou5f3.3 MO2
Synonyms: XLPOU60 mo
Target mRNA: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCTGTACAATATGGATTGGACCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 24/25
genomic

MO
5' ATGGACCAGCCCATATTGTACAGCC 3' |||| ||| ||||||||||||||| 3' TACCAGGTTAGGTATAACATGTCGG 5' 5' ATGGACCAATCCATATTGTACAGCC 3' |||| |||||||||||||||||||| 3' TACCAGGTTAGGTATAACATGTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:27458396..27458420 24/25 Antisense target pou5f3.3.S
chr8L:2135307..2135331 22/25 Antisense target pou5f3.3.L
chr5L:68137772..68137796 21/25 Antisense off-target pex3.L
chr7L:63467069..63467093 22/25 unknown
tropicalis 10.0 Chr4:120624442..120624466 22/25 Antisense off-target nptxr
Chr2:131012208..131012232 21/25 Sense off-target pcdh17
Publications
First: A conserved Oct4/POUV-dependent network links adhesion and migration to progenitor maintenance., Curr Biol 2013                                      
Most recent:
View All Papers