Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250124

Morpholino Name: pou5f3.3 MO3
Synonyms: Xlpou60, xlpou60a mo
mRNA Target: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence:
5' GTACAATATGGGCTGGTCCATCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGAGATGGACCAGCCCATATTGTAC 3' ||||||||||||||||||||||||| 3' CCTCTACCTGGTCGGGTATAACATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold37448:491962..491986 25/25 Antisense target pou5f3.3.L
Scaffold46073:2412607..2412631 22/25 Antisense off-target Xelaev16055867m
Publications
First: Conserved roles for Oct4 homologues in maintaining multipotency during early vertebrate development., Development 2006                  
Most recent: Spalt-like 4 promotes posterior neural fates via repression of pou5f3 family members in Xenopus., Development 2014                                                                  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556