Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250125

Morpholino Name: pou5f3.3 MO4
Synonyms: Oct-60MO, Oct60 Mo, Oct60MO
mRNA Target: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGGTCCATCTCCAGCACTTGCTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' GAGCAAGTGCTGGAGATGGACCAG 3' |||||||||||||||||||||||| 3' CTCGTTCACGACCTCTACCTGGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold37448:491974..491997 24/24 Antisense target pou5f3.3.L
Scaffold23301:4121636..4121659 21/24 Sense off-target Xelaev16030651m
Scaffold46073:2412596..2412619 21/24 Antisense off-target Xelaev16055867m
Scaffold123334:42690..42713 20/24 unknown
Scaffold145109:29..52 20/24 unknown
Scaffold15415:3378470..3378493 20/24 unknown
Scaffold160942:1506121..1506144 20/24 Antisense off-target dpys.L
Scaffold240816:200..223 20/24 unknown
Scaffold32657:3533548..3533571 20/24 Antisense off-target Xelaev16043396m
Scaffold332973:997693..997716 20/24 unknown
Scaffold73623:3323434..3323457 20/24 Sense off-target Xelaev16070748m
tropicalis 7.1 scaffold_1:185234318..185234341 20/24 Antisense off-target corin
scaffold_3:31201795..31201818 20/24 unknown
Publications
First: Oct-3/4 regulates stem cell identity and cell fate decisions by modulating Wnt/β-catenin signalling., EMBO J 2010  
Most recent: Negative autoregulation of Oct3/4 through Cdx1 promotes the onset of gastrulation., Dev Dyn 2011          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556