Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250125

Morpholino Name: pou5f3.3 MO4
Synonyms: Oct-60MO, Oct60 Mo, Oct60MO
Target mRNA: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGGTCCATCTCCAGCACTTGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 21/24
genomic

MO
5' GAGCAAGTGCTGGAGATGGACCAG 3' |||||||||||||||||||||||| 3' CTCGTTCACGACCTCTACCTGGTC 5' 5' GACCAAGTGCTGGAAATGGACCAA 3' || ||||||||||| |||||||| 3' CTCGTTCACGACCTCTACCTGGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:2135323..2135346 24/24 Antisense target pou5f3.3.L
chr8S:27458412..27458435 21/24 Antisense target pou5f3.3.S
chr6S:77304239..77304262 21/24 Sense off-target znf516.S
chr1L:30915462..30915485 20/24 Antisense off-target corin.L
chr6L:133623717..133623740 20/24 Antisense off-target dpys.L
chr6L:98119801..98119824 20/24 Sense off-target znf516.L
Scaffold89319:200..223 20/24 unknown
chr1L:169051449..169051472 20/24 unknown
chr1S:139613929..139613952 20/24 unknown
chr7L:102091131..102091154 20/24 unknown
tropicalis 10.0 Chr1:38594111..38594134 20/24 Antisense off-target corin
Chr3:115046274..115046297 20/24 unknown
Chr8:119639465..119639488 20/24 unknown
Publications
First: Oct-3/4 regulates stem cell identity and cell fate decisions by modulating Wnt/β-catenin signalling., EMBO J 2010  
Most recent: Negative autoregulation of Oct3/4 through Cdx1 promotes the onset of gastrulation., Dev Dyn 2011          
View All Papers