Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250126

Morpholino Name: pou5f3.3 MO5
Synonyms: Oct60- MOb1, Oct60MOb1, oct60 mo
Target mRNA: pou5f3.3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCATTTCCAACACTTGGTCCCGCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Xenopus POU factors of subclass V inhibit activin/nodal signaling during gastrulation., Mech Dev 2006              
Most recent: The Xenopus POU class V transcription factor XOct-25 inhibits ectodermal competence to respond to bone morphogenetic protein-mediated embryonic induction., Mech Dev 2007      
View All Papers