Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250131

Morpholino Name: ppfibp1 MO1
Synonyms: xLiprin beta 1 MO, xLiprin beta1 MO
mRNA Target: ppfibp1

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCACTTGCGTCCGACATCATGTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' AAGATGATGACGGACGCAAGTGAA 3' || |||||| |||||||||||||| 3' TTGTACTACAGCCTGCGTTCACTT 5' 5' AACATGATGTCGGACGCAAGTGAA 3' |||||||||||||||||||||||| 3' TTGTACTACAGCCTGCGTTCACTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:1406309..1406332 24/24 Antisense target ppfibp1.S
chr3L:2259266..2259289 24/24 Antisense off-target ppfibp2.L
chr1L:913158..913181 20/24 unknown
tropicalis 10.0 Chr3:2650999..2651022 22/24 Antisense target ppfibp1
Chr3:2650999..2651022 22/24 Antisense off-target stk38l
Publications
First: Liprin (beta)1 is highly expressed in lymphatic vasculature and is important for lymphatic vessel integrity., Blood 2010  
Most recent:
View All Papers