Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250144

Morpholino Name: ppp2r5e MO1
Synonyms: PP2A : B56, PP2A\:B56epsilon
mRNA Target: ppp2r5e

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGGAGTGGTTGGTGCTGAGGACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGTCCTCAGCACCAACCACTCCTC 3' ||||||||||||||||||||||||| 3' TACAGGAGTCGTGGTTGGTGAGGAG 5' 5' ATGTCCTCAGCACCAACCACTCCTC 3' ||||||||||||||||||||||||| 3' TACAGGAGTCGTGGTTGGTGAGGAG 5' 5' ATGTCCTCAGCACCAACCACTCCTC 3' ||||||||||||||||||||||||| 3' TACAGGAGTCGTGGTTGGTGAGGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:77953996..77954020 25/25 Antisense target ppp2r5e.L
chr8S:8576244..8576268 25/25 Antisense target ppp2r5e.S
chr2L:54265642..54265666 21/25 unknown
tropicalis 10.0 Chr8:101422947..101422971 25/25 Antisense target ppp2r5e
Chr1:106575516..106575540 21/25 Antisense off-target rex1bd
Publications
First: PP2A:B56epsilon is required for Wnt/beta-catenin signaling during embryonic development., Development 2003              
Most recent: PP2A:B56{epsilon}, a substrate of caspase-3, regulates p53-dependent and p53-independent apoptosis during development., J Biol Chem 2010  
View All Papers