Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250151

Morpholino Name: prdm9 MO1
Synonyms: xfdl141
mRNA Target: LOC100135246

Morpholino Type: uncategorized morpholino
Sequence:
5' TCTTGCAGTACTGAGGTTCTACTTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold223728:454913..454937 24/25 Antisense off-target Xelaev16029189m
Scaffold89755:1368126..1368150 22/25 unknown
Scaffold12518:8240775..8240799 21/25 Sense off-target zc3hc1.L
Scaffold15038:2032663..2032687 21/25 Sense off-target Xelaev16014775m
Scaffold172068:1546379..1546403 21/25 Antisense off-target trpc1.L
Publications
First: Ectodermal factor restricts mesoderm differentiation by inhibiting p53., Cell 2008                          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556