Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250152

Morpholino Name: prickle1 MO1
Synonyms: Pk1, XpkU MO, xPrickle1 MO
mRNA Target: prickle1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTCTGATCCATTTCCAAAGGCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 22/25 25/25
genomic

MO
5' CATGCCTTTGGAAATGGATCAGAAA 3' |||||||||||||||||||||||| 3' GTACGGAAACCTTTACCTAGTCTTC 5' 5' CATGTCGTTGGAAATGGATCAGAAA 3' |||| | ||||||||||||||||| 3' GTACGGAAACCTTTACCTAGTCTTC 5' 5' CATGCCTTTGGAAATGGATCAGAAG 3' ||||||||||||||||||||||||| 3' GTACGGAAACCTTTACCTAGTCTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold74339:3126053..3126077 25/25 Antisense target prickle1.S
Scaffold30470:3589799..3589823 22/25 Antisense target prickle1.L
Scaffold25194:3025731..3025755 21/25 unknown
Scaffold30003:450051..450075 21/25 Antisense off-target Xelaev16040350m
Scaffold30483:1624544..1624568 21/25 Antisense off-target nutf2.L
Scaffold409592:446991..447015 21/25 unknown
tropicalis 7.1 scaffold_3:93276281..93276305 24/25 Antisense target prickle1
scaffold_6:80430985..80431009 22/25 Sense off-target lars2
scaffold_4:26874761..26874785 21/25 Antisense off-target nutf2
scaffold_4:53031598..53031622 21/25 unknown
Publications
First: The prickle-related gene in vertebrates is essential for gastrulation cell movements., Curr Biol 2003          
Most recent: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation., J Cell Biol 2015                      
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556