Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250153

Morpholino Name: prickle1 MO2
Synonyms: XpkA MO
mRNA Target: prickle1

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTTCTGATCCATTTCCAAAGGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25 25/25
genomic

MO
5' ATGCCTTTGGAAATGGATCAGAAAA 3' ||||||||||||||||||||||| 3' TACGGAAACCTTTACCTAGTCTTCC 5' 5' ATGTCGTTGGAAATGGATCAGAAAG 3' ||| | ||||||||||||||||| | 3' TACGGAAACCTTTACCTAGTCTTCC 5' 5' ATGCCTTTGGAAATGGATCAGAAGG 3' ||||||||||||||||||||||||| 3' TACGGAAACCTTTACCTAGTCTTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold74339:3126052..3126076 25/25 Antisense target prickle1.S
Scaffold30470:3589798..3589822 22/25 Antisense target prickle1.L
Scaffold191023:223715..223739 21/25 unknown
Scaffold25194:3025730..3025754 21/25 unknown
tropicalis 7.1 scaffold_3:93276282..93276306 23/25 Antisense target prickle1
scaffold_5:93680865..93680889 21/25 unknown
scaffold_6:80430984..80431008 21/25 Sense off-target lars2
scaffold_7:101237851..101237875 21/25 unknown
Publications
First: Tes regulates neural crest migration and axial elongation in Xenopus., Dev Biol 2006                            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556