Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250169

Morpholino Name: ptk2 MO1
Synonyms: FAK MO, FAK Translational blocking MO, FAK morpholino, FAK-MO
Target mRNA: ptk2

Morpholino Type: uncategorized morpholino
Sequence: 5' TTGGGTCCAGGTAAGCCGCAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' ATGGCTGCGGCTTACCTGGACCCAA 3' ||||||||||||||||||||||||| 3' TACCGACGCCGAATGGACCTGGGTT 5' 5' ATGGCTGCGGCTTACCTGGACCCAA 3' ||||||||||||||||||||||||| 3' TACCGACGCCGAATGGACCTGGGTT 5' 5' ATGGCTGCAGCTTACCTGGACCCAA 3' |||||||| |||||||||||||||| 3' TACCGACGCCGAATGGACCTGGGTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:148843317..148843341 25/25 Antisense target ptk2.L
chr6S:123904773..123904797 24/25 Antisense target ptk2.S
tropicalis 10.0 Chr6:146655694..146655718 25/25 Antisense target ptk2
Chr6:10229369..10229393 21/25 unknown
Publications
First: Focal adhesion kinase protein regulates Wnt3a gene expression to control cell fate specification in the developing neural plate., Mol Biol Cell 2011                    
Most recent: FAK transduces extracellular forces that orient the mitotic spindle and control tissue morphogenesis., Nat Commun 2014        
View All Papers