Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250182

Morpholino Name: rab11a MO1
Synonyms: Rab11-MO
mRNA Target: rab11a

Morpholino Type:
Sequence:
5' TACCCATCGTCGCGGCACTTCTGAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTCAGAAGTGCCGCGACGATGGGTA 3' ||||||||||||||||||||||||| 3' CAGTCTTCACGGCGCTGCTACCCAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold36401:4254463-4254487 25/25 Antisense target rab11a.S
Scaffold58049:4266278-4266302 23/25 Antisense off-target Xelaev16063763m
Publications
First: Rab11 regulates planar polarity and migratory behavior of multiciliated cells in Xenopus embryonic epidermis. [Dev Dyn 2012]
Most recent: Vangl2 cooperates with Rab11 and Myosin V to regulate apical constriction during vertebrate gastrulation. [Development 2015]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556