Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250183

Morpholino Name: rab3d MO1
Synonyms: Rab3d
mRNA Target: rab3d

Morpholino Type:
Sequence:
5' GGTGCAGTCTCTTGCTCGGGTGTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 24/25 23/25
genomic

MO
5' AGGCACCCAAGCCAGAGACTGCACC 3' || ||||| ||| |||||||||||| 3' TCTGTGGGCTCGTTCTCTGACGTGG 5' 5' AGACACCCGAGCTAGAGACTGCACC 3' |||||||||||| |||||||||||| 3' TCTGTGGGCTCGTTCTCTGACGTGG 5' 5' AGGAACCCGAGCAAGAGACTGCACC 3' || ||||||||||||||||||||| 3' TCTGTGGGCTCGTTCTCTGACGTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold55171:478578-478602 24/25 Antisense target rab3d.L
Scaffold49557:596006-596030 23/25 Antisense target rab3d.S
Scaffold80885:641136-641160 21/25 unknown
tropicalis 7.1 scaffold_26:924912-924936 22/25 Antisense target rab3d
scaffold_6:133836189-133836213 21/25 Antisense off-target setd2
Publications
First: Rab3d is required for Xenopus anterior neurulation by regulating Noggin secretion. [Dev Dyn 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556