Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250184

Morpholino Name: rab40c MO1
Synonyms: XRab40 Mo
mRNA Target: rab40c

Morpholino Type:
Sequence:
5' GCTGCCCTGTGTGCCCATCCTCCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGGGAGGATGGGCACACAGGGCAGC 3' ||||||||||||||||||||||||| 3' TCCCTCCTACCCGTGTGTCCCGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold23403:5288707..5288731 25/25 Antisense target rab40c.L
Scaffold939:1469096..1469120 24/25 Antisense off-target Xelaev16079314m
tropicalis 7.1 scaffold_9:77155631..77155655 24/25 Antisense off-target rab40b
scaffold_1:5174452..5174476 21/25 Sense off-target dym
scaffold_1813:3630..3654 21/25 unknown
scaffold_1813:3749..3773 21/25 unknown
scaffold_6:126755392..126755416 21/25 unknown
Publications
First: XRab40 and XCullin5 form a ubiquitin ligase complex essential for the noncanonical Wnt pathway. [EMBO J 2007]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556