Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250185

Morpholino Name: rab8b MO1
Synonyms: rab8b MO2
mRNA Target: rab8b

Morpholino Type:
Sequence:
5' AAGTCTTCGCCATCTTTAGTCCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GGAGGACTAAAGATGGCGAAGACTT 3' ||||||||||||||||||||||||| 3' CCTCCTGATTTCTACCGCTTCTGAA 5' 5' GGACGACTAAAGATGGCGAAGACTT 3' ||| ||||||||||||||||||||| 3' CCTCCTGATTTCTACCGCTTCTGAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold253809:930719-930743 25/25 Antisense off-target Xelaev16034136m
Scaffold12518:3722217-3722241 24/25 Antisense target rab8b.L
Scaffold13204:1143657-1143681 21/25 Antisense off-target ppp1r8.L
tropicalis 7.1 scaffold_7:50949877-50949901 25/25 Antisense target rab8b
scaffold_2:2537248-2537272 21/25 Antisense off-target ppp1r8
Publications
First: RAB8B is required for activity and caveolar endocytosis of LRP6. [Cell Rep 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556