Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250186

Morpholino Name: rab8b MO2
Synonyms: rab8b Mo1
mRNA Target: rab8b

Morpholino Type:
Sequence:
5' GGTAGTCGTAAGTCTTCGCCATCTT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' AAGATGGCGAAGACTTACGACTACC 3' ||||||||||||||||||||||||| 3' TTCTACCGCTTCTGAATGCTGATGG 5' 5' AAGATGGCGAAGACTTATGACTACC 3' ||||||||||||||||| ||||||| 3' TTCTACCGCTTCTGAATGCTGATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold253809:930728-930752 25/25 Antisense off-target Xelaev16034136m
Scaffold12518:3722226-3722250 24/25 Antisense target rab8b.L
Scaffold231526:1054243-1054267 21/25 Antisense off-target rab8a.S
Scaffold72621:311790-311814 21/25 unknown
tropicalis 7.1 scaffold_7:50949886-50949910 25/25 Antisense target rab8b
scaffold_1:122155376-122155400 21/25 Antisense off-target rab8a
scaffold_6:76146318-76146342 21/25 unknown
scaffold_6:89673914-89673938 21/25 unknown
scaffold_9:52371320-52371344 21/25 unknown
Publications
First: RAB8B is required for activity and caveolar endocytosis of LRP6. [Cell Rep 2013]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556