Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250187

Morpholino Name: rac1 MO1
Synonyms: XRac1 MO
mRNA Target: rac1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCTGCATGGCAGCGAATGTCCCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold23403:7625591..7625614 23/24 unknown
Scaffold41091:2905927..2905950 20/24 Sense off-target mef2d.S
tropicalis 7.1 scaffold_1:215646935..215646958 20/24 unknown
Publications
First: Coactivation of Rac and Rho by Wnt/Frizzled signaling is required for vertebrate gastrulation., Genes Dev 2003  
Most recent: The Rac1 regulator ELMO controls basal body migration and docking in multiciliated cells through interaction with Ezrin., Development 2015                                              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556