Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250188

Morpholino Name: racgap1 MO1
Synonyms: MgcRacGAP UTR2
mRNA Target: racgap1

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCTAATGGCACGGGAAGCCGGAAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GATCCGGCTTCCCGTGCCATTAGAA 3' | ||||||||||||||||||||||| 3' CAAGGCCGAAGGGCACGGTAATCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold200825:6164507..6164531 24/25 Antisense target racgap1.L
tropicalis 7.1 scaffold_79:117828..117852 21/25 Antisense off-target wiz
scaffold_9:74571525..74571549 21/25 Sense off-target otoa
Publications
First: Regulation of cytokinesis by Rho GTPase flux., Nat Cell Biol 2009        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556