Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250189

Morpholino Name: racgap1 MO2
Synonyms: MgcRacGAP
mRNA Target: racgap1

Morpholino Type: uncategorized morpholino
Sequence:
5' TAGGTTCATCAGGTTTGTCGCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GATGGCGACAAACCTGATGAACCTA 3' ||||||||||||||||||||||||| 3' CTACCGCTGTTTGGACTACTTGGAT 5' 5' GATGGCGACAAACCTGATGAACCTA 3' ||||||||||||||||||||||||| 3' CTACCGCTGTTTGGACTACTTGGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold200825:6172715..6172739 25/25 Antisense target racgap1.L
Scaffold5732:9272303..9272327 25/25 Antisense off-target Xelaev16063253m
Scaffold47533:472420..472444 21/25 Sense off-target Xelaev16056854m
tropicalis 7.1 scaffold_2:92670521..92670545 25/25 Antisense target racgap1
Publications
First: Regulation of cytokinesis by Rho GTPase flux., Nat Cell Biol 2009        
Most recent: MgcRacGAP restricts active RhoA at the cytokinetic furrow and both RhoA and Rac1 at cell-cell junctions in epithelial cells., Mol Biol Cell 2015                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556