Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250190

Morpholino Name: racgap1 MO3
Synonyms: MgcRacGAP UTR1
mRNA Target: racgap1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCACTCTCAGTGACACGCAGCCG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5732:9277470..9277493 23/24 Antisense off-target Xelaev16063253m
Scaffold169011:576768..576791 20/24 Antisense off-target timmdc1.L
Publications
First: Regulation of cytokinesis by Rho GTPase flux., Nat Cell Biol 2009        
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556