Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250191

Morpholino Name: ran MO1
Synonyms: xRan1-MO
mRNA Target: ran

Morpholino Type: uncategorized morpholino
Sequence:
5' AGTTTGTCAGCCTTCCAGAAGCGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: IQGAP1 protein regulates nuclear localization of β-catenin via importin-β5 protein in Wnt signaling., J Biol Chem 2013  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556