Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250193

Morpholino Name: rap2b MO1
Synonyms: XRap2B MO
mRNA Target: rap2b

Morpholino Type: uncategorized morpholino
Sequence:
5' CAACTACTTTGTATTCCCGCATGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GCCATGCGGGAATACAAAGTAGTTG 3' ||||||||||||||||||||||||| 3' CGGTACGCCCTTATGTTTCATCAAC 5' 5' GCCATGCGGGAATACAAAGTAGTTG 3' ||||||||||||||||||||||||| 3' CGGTACGCCCTTATGTTTCATCAAC 5' 5' GCCATGCGGGAATACAAAGTAGTTG 3' ||||||||||||||||||||||||| 3' CGGTACGCCCTTATGTTTCATCAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:114418855..114418879 25/25 Antisense target rap2b.L
chr5S:98066327..98066351 25/25 Antisense target rap2b.S
Scaffold211:27681..27705 21/25 unknown
chr1S:76067211..76067235 21/25 unknown
chr3S:60270141..60270165 21/25 Antisense off-target LOC108713002
Scaffold59:927791..927815 21/25 Antisense off-target galnt1.S
tropicalis 10.0 Chr5:117182688..117182712 25/25 Antisense target rap2b
Publications
First: Rap2 is required for Wnt/beta-catenin signaling pathway in Xenopus early development., EMBO J 2005  
Most recent: Role of the Rap2/TNIK kinase pathway in regulation of LRP6 stability for Wnt signaling., Biochem Biophys Res Commun 2013          
View All Papers