Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250201

Morpholino Name: rarg MO1
Synonyms: Rar gamma 1.L/S , Rargamma1
Target mRNA: rarg

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGTTTGCCATTGCCTTGTTCTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' GAGAACAAGACAATGGCAAACAGC 3' |||||||| |||||||||||||| 3' ATCTTGTTCCGTTACCGTTTGTCG 5' 5' TAGAACAAGGCAATGGCAAACAGC 3' |||||||||||||||||||||||| 3' ATCTTGTTCCGTTACCGTTTGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:129913310..129913333 24/24 Antisense target rarg.S
chr2L:149499481..149499504 23/24 Antisense off-target LOC100485387-like.1.L
chr2L:149499481..149499504 23/24 Antisense off-target LOC108708649 [provisional:rarg]
chr1S:151407387..151407410 21/24 Sense off-target mef2c.S
chr3L:16620149..16620172 21/24 unknown
chr3L:16625131..16625154 21/24 unknown
chr5S:85323812..85323835 21/24 unknown
chr6S:33169020..33169043 21/24 unknown
chr1S:151150958..151150981 20/24 unknown
chr2S:25601475..25601498 20/24 unknown
chr4L:80814409..80814432 20/24 unknown
chr5L:20387925..20387948 20/24 unknown
chr9_10L:66954454..66954477 20/24 unknown
tropicalis 10.0 Chr2:147287088..147287111 22/24 Antisense target rarg
Chr6:62975732..62975755 21/24 Sense off-target pou6f2
Chr2:176095761..176095784 20/24 Sense off-target LOC100486100
Chr1:130184287..130184310 20/24 unknown
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent: RARγ is required for mesodermal gene expression prior to gastrulation in Xenopus., Development 2018                            
View All Papers