Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250202

Morpholino Name: rarg MO2
Synonyms: Rargamma2
Target mRNA: rarg

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCCATGCAGTCATACATTTTGGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24 24/24 23/24
genomic

MO
5' GCCAACATGTACGACTGCATGGAA 3' |||| ||||| |||||||||||| 3' GGGTTTTACATACTGACGTACCTT 5' 5' CCCAAAATGTATGACTGCATGGAA 3' |||||||||||||||||||||||| 3' GGGTTTTACATACTGACGTACCTT 5' 5' CCCAAAATGTACGACTGCATGGAA 3' ||||||||||| |||||||||||| 3' GGGTTTTACATACTGACGTACCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:149564119..149564142 24/24 Antisense target rarg.L
chr2S:129984573..129984596 23/24 Antisense target rarg.S
chr2L:149564119..149564142 24/24 Antisense off-target LOC108708649 [provisional:rarg]
chr2S:129984573..129984596 23/24 Sense off-target Xelaev18016063m
chr2S:87057388..87057411 21/24 Antisense off-target nf1.S
chr9_10L:79214501..79214524 21/24 Sense off-target bmpr2.L
chr1S:139048296..139048319 20/24 Antisense off-target aifm3.S
chr3L:97351580..97351603 20/24 Antisense off-target tp53bp1.L
chr4L:41302704..41302727 20/24 Sense off-target LOC108713498 [provisional:nlrc5]
chr4L:41302704..41302727 20/24 Sense off-target nlrc5.L
chr7L:77688248..77688271 20/24 Sense off-target dixdc1.L
chr6L:96377749..96377772 21/24 unknown
chr1L:108830154..108830177 20/24 unknown
chr1L:92747812..92747835 20/24 unknown
chr5S:68834935..68834958 20/24 unknown
chr6S:50777104..50777127 20/24 unknown
chr8L:67723777..67723800 20/24 unknown
tropicalis 10.0 Chr2:147345420..147345443 21/24 Antisense target rarg
Chr3:118133192..118133215 22/24 Sense off-target adamts7
Chr7:60240440..60240463 21/24 Antisense off-target ftsj3
Chr2:128785707..128785730 20/24 Antisense off-target pcdh9
Chr1:182470804..182470827 20/24 Sense off-target LOC116406436
Chr1:183815491..183815514 21/24 unknown
Chr3:88516699..88516722 20/24 unknown
Chr9:55016231..55016254 20/24 unknown
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent: RARβ2 is required for vertebrate somitogenesis., Development 2017                                                
View All Papers