Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250209

Morpholino Name: rax MO1
Synonyms: Xrx1 AMO
mRNA Target: rax

Morpholino Type: uncategorized morpholino
Sequence:
5' TCGGGAAGGGCTGTGCAGGTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/24 20/24 22/24
genomic

MO
5' ATGCACCTGCACAGTCCTTCCCTG 3' |||||||||||||| ||||||| 3' TACGTGGACGTGTCGGGAAGGGCT 5' 5' ATGCACCTGCACAGTCCTCCCCTG 3' |||||||||||||| ||| ||| 3' TACGTGGACGTGTCGGGAAGGGCT 5' 5' ATGCACCTGCACAGCCCTTCCCTG 3' |||||||||||||||||||||| 3' TACGTGGACGTGTCGGGAAGGGCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold51452:4372849..4372872 22/24 Antisense target rax.S
Scaffold20754:488683..488706 20/24 unknown
Scaffold231526:418215..418238 20/24 unknown
Scaffold52441:2507842..2507865 20/24 Antisense target rax.L
Scaffold79772:483062..483085 20/24 unknown
tropicalis 7.1 scaffold_1:18626470..18626493 21/24 Antisense target rax
scaffold_6:46296437..46296460 20/24 Sense off-target tubb6
Publications
First: Xrx1 controls proliferation and neurogenesis in Xenopus anterior neural plate., Development 2003                
Most recent: Nucleosome regulator Xhmgb3 is required for cell proliferation of the eye and brain as a downstream target of Xenopus rax/Rx1., Dev Biol 2006            
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556