Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250209

Morpholino Name: rax MO1
Synonyms: Xrx1 AMO
Target mRNA: rax

Morpholino Type: uncategorized morpholino
Sequence: 5' TCGGGAAGGGCTGTGCAGGTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24 20/24 22/24
genomic

MO
5' ATGCACCTGCACAGTCCTTCCCTG 3' |||||||||||||| ||||||| 3' TACGTGGACGTGTCGGGAAGGGCT 5' 5' ATGCACCTGCACAGTCCTCCCCTG 3' |||||||||||||| ||| ||| 3' TACGTGGACGTGTCGGGAAGGGCT 5' 5' ATGCACCTGCACAGCCCTTCCCTG 3' |||||||||||||||||||||| 3' TACGTGGACGTGTCGGGAAGGGCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:169564616..169564639 22/24 Antisense target rax.S
chr1L:205726720..205726743 20/24 Antisense target rax.L
chr1S:89313784..89313807 20/24 unknown
chr7L:12427044..12427067 20/24 unknown
Scaffold61:406528..406551 20/24 unknown
tropicalis 10.0 Chr1:201402406..201402429 21/24 Antisense target rax
Chr6:103750994..103751017 20/24 Sense off-target tubb6
Publications
First: Xrx1 controls proliferation and neurogenesis in Xenopus anterior neural plate., Development 2003                
Most recent: Nucleosome regulator Xhmgb3 is required for cell proliferation of the eye and brain as a downstream target of Xenopus rax/Rx1., Dev Biol 2006            
View All Papers