Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250210

Morpholino Name: rax MO2
Synonyms: Xrx1 antisense morpholino, rax/Rx1
mRNA Target: rax

Morpholino Type: uncategorized morpholino
Sequence:
5' TCAGGGAAGGGCTGTGCAGGTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 23/25 25/25
genomic

MO
5' ATGCACCTGCACAGTCCTTCCCTGA 3' |||||||||||||| |||||||||| 3' TACGTGGACGTGTCGGGAAGGGACT 5' 5' ATGCACCTGCACAGTCCTCCCCTGA 3' |||||||||||||| ||| |||||| 3' TACGTGGACGTGTCGGGAAGGGACT 5' 5' ATGCACCTGCACAGCCCTTCCCTGA 3' ||||||||||||||||||||||||| 3' TACGTGGACGTGTCGGGAAGGGACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold51452:4372849..4372873 25/25 Antisense target rax.S
Scaffold52441:2507841..2507865 23/25 Antisense target rax.L
Scaffold76824:139884..139908 21/25 unknown
tropicalis 7.1 scaffold_1:18626469..18626493 24/25 Antisense target rax
Publications
First: Role of Xrx1 in Xenopus eye and anterior brain development., Development 1999              
Most recent: Characterization of the Rx1-dependent transcriptome during early retinal development., Dev Dyn 2014                                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556