Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250230

Morpholino Name: reep4 MO2
Synonyms: TEgg068f10, Xtnovel51
mRNA Target: reep4

Morpholino Type:
Sequence:
5' CGAGAGATGATCCAGGATACCATTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAATGGTATCCTGGATCATCTCTCG 3' ||||||||||||||||||||||||| 3' CTTACCATAGGACCTAGTAGAGAGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold139741:768400-768424 22/25 Antisense off-target Xelaev16012408m
Scaffold100253:2937715-2937739 21/25 Antisense off-target Xelaev16000137m
Scaffold230826:3999882-3999906 21/25 Sense off-target Xelaev16030009m
Scaffold5925:9420875-9420899 21/25 unknown
tropicalis 7.1 scaffold_3:8164903-8164927 25/25 Antisense target reep4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides. [PLoS Genet 2006]
Most recent: Loss of REEP4 causes paralysis of the Xenopus embryo. [Int J Dev Biol 2009]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556