Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250233

Morpholino Name: rest MO1
Synonyms: MoXREST
Target mRNA: rest

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTGGTTGACCATTTGAGTGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/22 21/22 22/22
genomic

MO
5' GCCACTCAAATGGTCAACCAGC 3' ||||||||||||||||||||| 3' CGGTGAGTTTACCAGTTGGTCA 5' 5' GCCACTCAAATGGTCAACCAGG 3' ||||||||||||||||||||| 3' CGGTGAGTTTACCAGTTGGTCA 5' 5' GCCACTCAAATGGTCAACCAGT 3' |||||||||||||||||||||| 3' CGGTGAGTTTACCAGTTGGTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:76779633..76779654 22/22 Antisense target rest.S
chr1L:87587643..87587664 21/22 Antisense target rest.L
chr2L:167324099..167324120 19/22 Antisense off-target amotl1.L
chr2S:147449268..147449289 19/22 Antisense off-target amotl1.S
chr4L:48794153..48794174 19/22 Sense off-target Xetrov90011510m.L
chr3S:83748226..83748247 18/22 Sense off-target pawr.S
chr8S:27537099..27537120 18/22 Antisense off-target entpd2.S
chr9_10S:102894875..102894896 20/22 unknown
chr1S:68629055..68629076 18/22 unknown
chr2L:175432876..175432897 18/22 unknown
chr5L:102209300..102209321 18/22 unknown
tropicalis 10.0 Chr1:92149995..92150016 21/22 Antisense target rest
Chr9:12165607..12165628 20/22 Antisense off-target LOC100495179
Chr2:164974993..164975014 19/22 Antisense off-target amotl1
Chr3:62370243..62370264 19/22 Antisense off-target syt1
Publications
First: Repressor element-1 silencing transcription/neuron-restrictive silencer factor is required for neural sodium channel expression during development of Xenopus., J Neurosci 2002                  
Most recent: RE-1 silencer of transcription/neural restrictive silencer factor modulates ectodermal patterning during Xenopus development., J Neurosci 2006                      
View All Papers