Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250234

Morpholino Name: rfx2 MO1
Synonyms: Rfx2, Rfx2 MO
mRNA Target: rfx2

Morpholino Type: uncategorized morpholino
Sequence:
5' AATTCTGCATACTGGTTTCTCCGTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 21/25
genomic

MO
5' GACGGAGAAACCAGCATGCAGAATT 3' |||||||||||||| |||||||||| 3' CTGCCTCTTTGGTCATACGTCTTAA 5' 5' TTCACAGAAACCAGTATGCAGAATT 3' | |||||||||||||||||||| 3' CTGCCTCTTTGGTCATACGTCTTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold325448:542214..542238 21/25 Antisense off-target Xelaev16043168m
Scaffold35716:1574762..1574786 21/25 Antisense target rfx2.S
Scaffold362948:146379..146403 21/25 Antisense off-target Xelaev16047174m
tropicalis 7.1 scaffold_1:124667625..124679369 24/25 Antisense target rfx2
scaffold_3:7645860..7645884 21/25 Sense off-target rhobtb2
scaffold_3:97094063..97094087 21/25 Sense off-target cttnbp2
scaffold_5:78121205..78121229 21/25 Sense off-target slc35d3
Publications
First: RFX2 is broadly required for ciliogenesis during vertebrate development., Dev Biol 2012                                                            
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556