Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250238

Morpholino Name: rfx7 MO2
Synonyms: RFX7MO
mRNA Target: rfx7

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTGTTCAGTAAGCCACAATGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16863:3754351..3754374 20/24 unknown
Scaffold98999:5024802..5024825 20/24 unknown
tropicalis 7.1 scaffold_7:43828720..43828743 20/24 unknown
scaffold_8:84514530..84514553 20/24 Sense off-target snap23
scaffold_9:41909133..41909156 20/24 unknown
Publications
First: RFX7 is required for the formation of cilia in the neural tube., Mech Dev 2014                    
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556