Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250253

Morpholino Name: ephb4 MO1
Synonyms: rnf121 MO1
mRNA Target: ephb4

Morpholino Type: Translation Blocking(ATG)
Sequence:
5' ACAGGAGGAGGAGCCAGAGATCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' ATAGATCCCAGGCTCCTCCTCCTGT 3' || |||| | ||||||||||||||| 3' TACCTAGAGACCGAGGAGGAGGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold113187:1610455..1610479 25/25 Antisense off-target Xelaev16003704m
Scaffold32657:3253245..3253269 22/25 Sense off-target tec.L
Scaffold128184:151618..151642 21/25 Sense off-target Xelaev16007946m
Scaffold18670:197554..197578 21/25 unknown
Scaffold28181:212859..212883 21/25 Sense off-target Xelaev16038413m
Scaffold94062:25203..25227 21/25 unknown
tropicalis 7.1 scaffold_546:11392..11416 22/25 Antisense target rnf121
scaffold_2:136505916..136505940 21/25 unknown
scaffold_8b:1027564..1027588 21/25 unknown
Publications
First: A molecular base for cell sorting at embryonic boundaries: contact inhibition of cadherin adhesion by ephrin/ Eph-dependent contractility. [Dev Cell 2013]
Most recent: Sorting at embryonic boundaries requires high heterotypic interfacial tension. [Nat Commun 2017]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556