Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250262

Morpholino Name: rspo3 MO1
Synonyms: Rspo3, X.tropicalis Rspo3, gi:114149217
mRNA Target: rspo3

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAGAGAAAGCAGTCGCAATTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGCAATTGCGACTGCTTTCTCTGT 3' ||||||||||||||||||||||||| 3' TACGTTAACGCTGACGAAAGAGACA 5' 5' ATGCAATTGCGACTGCTTTCTCTGT 3' ||||||||||||||||||||||||| 3' TACGTTAACGCTGACGAAAGAGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:64536318..64536342 25/25 Antisense target rspo3.L
chr1L:110230271..110230295 21/25 Sense off-target LOC108695304 [provisional:gtpbp3]
chr3L:96280012..96280036 21/25 Sense off-target efl1.L
chr7S:47533236..47533260 21/25 Sense off-target arhgap32.S
chr5S:17090762..17090786 21/25 Antisense off-target vash2.S
chr4S:82685683..82685707 22/25 unknown
chr9_10S:55246460..55246484 22/25 unknown
tropicalis 10.0 Chr5:67823000..67823024 25/25 Antisense target rspo3
Chr7:24725562..24725586 21/25 Sense off-target adam12
Publications
First: The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development., Development 2008                  
Most recent: Rspo3 binds syndecan 4 and induces Wnt/PCP signaling via clathrin-mediated endocytosis to promote morphogenesis., Dev Cell 2011        
View All Papers