Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250262

Morpholino Name: rspo3 MO1
Synonyms: Rspo3, X.tropicalis Rspo3, gi:114149217
mRNA Target: rspo3

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAGAGAAAGCAGTCGCAATTGCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGCAATTGCGACTGCTTTCTCTGT 3' ||||||||||||||||||||||||| 3' TACGTTAACGCTGACGAAAGAGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold275651:192485..192509 25/25 Antisense off-target Xelaev16037906m
Scaffold4321:11968054..11968078 22/25 unknown
Scaffold74267:816818..816842 22/25 unknown
Scaffold27161:1853659..1853683 21/25 Antisense off-target Xelaev16037040m
Scaffold70461:2051831..2051855 21/25 unknown
Scaffold75966:240208..240232 21/25 Sense off-target Xelaev16072612m
Scaffold9266:4943661..4943685 21/25 Sense off-target Xelaev16078745m
tropicalis 7.1 scaffold_5:57618176..57618200 25/25 Antisense target rspo3
scaffold_3:37369126..37369150 21/25 unknown
Publications
First: The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development., Development 2008                  
Most recent: Rspo3 binds syndecan 4 and induces Wnt/PCP signaling via clathrin-mediated endocytosis to promote morphogenesis., Dev Cell 2011        
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556