Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250263

Morpholino Name: runx1 MO1
Synonyms: Runx1MO
mRNA Target: runx1

Morpholino Type: uncategorized morpholino
Sequence:
5' CACTATGTGAGGCCATTGCGTTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 23/25
genomic

MO
5' GCACACGCGATGGCCTCACATAGTG 3' | | |||| |||||||||||||||| 3' CCTTTGCGTTACCGGAGTGTATCAC 5' 5' GCACACGCAATGGCCTCACATAGTG 3' | | ||||||||||||||||||||| 3' CCTTTGCGTTACCGGAGTGTATCAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:12901825..12901849 23/25 Antisense target runx1.L
chr2S:20708522..20708546 22/25 unknown
tropicalis 10.0 Chr2:13824072..13824096 22/25 Antisense target runx1
Publications
First: Xaml1/Runx1 is required for the specification of Rohon-Beard sensory neurons in Xenopus., Dev Biol 2012                  
Most recent:
View All Papers