Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250264

Morpholino Name: runx1 MO2
Synonyms: Aml1MO
mRNA Target: runx1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGGATACGCATCACAACAAGCCTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CCAGGCTTGTTGTGATGCGTATCCC 3' ||||||||||||||||||||||||| 3' GGTCCGAACAACACTACGCATAGGG 5' 5' CCAGGCTTGTTGTGATGCGTATCCC 3' ||||||||||||||||||||||||| 3' GGTCCGAACAACACTACGCATAGGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:12988119..12988143 25/25 Antisense target runx1.L
chr2S:20630842..20630866 25/25 Antisense off-target LOC108709238 [provisional:runx1]
tropicalis 10.0 Chr2:13900582..13900606 25/25 Antisense target runx1
Publications
First: Xaml1/Runx1 is required for the specification of Rohon-Beard sensory neurons in Xenopus., Dev Biol 2012                  
Most recent:
View All Papers