Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250265

Morpholino Name: runx1 MO3
Synonyms: Runx1SMO
mRNA Target: runx1

Morpholino Type: uncategorized morpholino
Sequence:
5' AAACAGAGCCAGGGTCTTACCTTGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' TCAAGGTAAGACCCTGGCACTGTGA 3' |||||||||||||||||| |||| 3' AGTTCCATTCTGGGACCGAGACAAA 5' 5' TCAAGGTAAGACCCTGGCTCTGTTT 3' ||||||||||||||||||||||||| 3' AGTTCCATTCTGGGACCGAGACAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:12988398..12988422 25/25 Antisense target runx1.L
chr5L:81181998..81182022 22/25 Antisense off-target prep.L
chr4L:27509122..27509146 21/25 Antisense off-target kat5.L
tropicalis 10.0 Chr2:13900861..13900885 22/25 Antisense target runx1
Publications
First: Xaml1/Runx1 is required for the specification of Rohon-Beard sensory neurons in Xenopus., Dev Biol 2012                  
Most recent:
View All Papers