Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250266

Morpholino Name: runx1t1 MO1
Synonyms: mtg8
mRNA Target: runx1t1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTGCTTGAGATTCCCACCATTCGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold100704:893168..893192 25/25 Antisense off-target Xelaev16000211m
Scaffold254257:159209..159233 25/25 Sense off-target Xelaev16034244m
Scaffold27036:730844..730868 21/25 unknown
Scaffold82102:2394430..2394454 21/25 unknown
tropicalis 7.1 scaffold_6:22808519..22808543 25/25 unknown
Publications
First: Transient expression of Ngn3 in Xenopus endoderm promotes early and ectopic development of pancreatic beta and delta cells., Genesis 2012                          
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556