Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250267

Morpholino Name: runx2 MO1
Synonyms: runx2
mRNA Target: runx2

Morpholino Type: uncategorized morpholino
Sequence:
5' AGCTGAACAGACTGTTGGACGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold155263:691505..691529 25/25 unknown
Scaffold41523:8183209..8183233 24/25 unknown
tropicalis 7.1 scaffold_9:90950148..90950172 25/25 unknown
scaffold_9:22227660..22227684 22/25 Antisense off-target sestd1
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556