Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250273

Morpholino Name: sall2 MO1
Synonyms: XsalF-A- specific
mRNA Target: sall2

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTAAAATCTGATCTCTCCTACGGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACCGTAGGAGAGATCAGATTTTACC 3' ||||||||||||||||||||||||| 3' TGGCATCCTCTCTAGTCTAAAATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:140918350..140918374 25/25 Antisense target sall2.L
Publications
First: Xenopus XsalF: anterior neuroectodermal specification by attenuating cellular responsiveness to Wnt signaling., Dev Cell 2004              
Most recent:
View All Papers