Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250274

Morpholino Name: sall2 MO2
Synonyms: XsalF
mRNA Target: sall2

Morpholino Type:
Sequence:
5' CGACATCTCCACCACTCCTAATTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ACAATTAGGAGTGGTGGAGATGTCG 3' ||||||||||||||||||||||||| 3' TGTTAATCCTCACCACCTCTACAGC 5' 5' ACAATTAGGAGTGGTGGAGATGTCG 3' ||||||||||||||||||||||||| 3' TGTTAATCCTCACCACCTCTACAGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold272406:220151-220175 25/25 Antisense target sall2.L
Scaffold61078:643284-643308 25/25 Antisense off-target Xelaev16065846m
Scaffold133814:1272293-1272317 21/25 unknown
Scaffold18726:1580808-1580832 21/25 unknown
tropicalis 7.1 scaffold_1:83652466-83652490 25/25 Antisense target sall2
scaffold_5:84851214-84851238 21/25 unknown
Publications
First: Xenopus XsalF: anterior neuroectodermal specification by attenuating cellular responsiveness to Wnt signaling. [Dev Cell 2004]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556