Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250275

Morpholino Name: scyl2 MO1
Synonyms: CVAK104
mRNA Target: scyl2

Morpholino Type:
Sequence:
5' GTTTGTTTAGCATCGACTCCATTTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' AAAATGGAGTCGATGCTAAACAAAC 3' |||||||||||||||||||||||| 3' GTTTACCTCAGCTACGATTTGTTTG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5925:9180391-9180415 24/25 Antisense off-target Xelaev16064847m
Scaffold16001:7008364-7008388 21/25 Antisense off-target Xelaev16017244m
Scaffold299965:833486-833510 21/25 Antisense off-target Xelaev16040296m
tropicalis 7.1 scaffold_3:77172517-77172541 24/25 Antisense target scyl2
scaffold_6:45395990-45396014 21/25 Sense off-target ppp4r1
scaffold_7:8887117-8887141 21/25 unknown
Publications
First: CVAK104 is a novel regulator of clathrin-mediated SNARE sorting. [Traffic 2007]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556