Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250277

Morpholino Name: sdc1 MO2
Synonyms: xSyn1.2 MO
mRNA Target: sdc1

Morpholino Type:
Sequence:
5' ACAGGGCAACCAATAACTTGTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGGACAAGTTATTGGTTGCCCTGT 3' ||||||||||||||||||||||||| 3' TACCTGTTCAATAACCAACGGGACA 5' 5' ATGGACAAGTTACTGGCTGCCCTGT 3' |||||||||||| ||| |||||||| 3' TACCTGTTCAATAACCAACGGGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold93416:2152680-2152704 23/25 Antisense target sdc1.L
Scaffold149890:83004-83028 22/25 unknown
Scaffold12933:3781564-3781588 21/25 Sense off-target Xelaev16008357m
tropicalis 7.1 scaffold_9:95562630-95562654 25/25 Antisense target sdc1
scaffold_1:70429339-70429363 21/25 unknown
scaffold_7:90704871-90704895 21/25 unknown
Publications
First: Syndecan-1 regulates BMP signaling and dorso-ventral patterning of the ectoderm during early Xenopus development. [Dev Biol 2009]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556