Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250278

Morpholino Name: sdc4 MO1
Synonyms: Sdc4, syn4 MO1, xSyn4.1 MO
mRNA Target: sdc4

Morpholino Type: translation blocking morpholino
Sequence:
5' GCACAAACAGCAGGGTCGGACTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' ATGAGTCCGACCCTGATGTTTGTGC 3' ||||||||||||||| ||||||||| 3' TACTCAGGCTGGGACGACAAACACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:3576721..3576745 24/25 Antisense target sdc4.S
chr8S:31833269..31833293 21/25 Antisense off-target LOC108699933 [provisional:cfap77]
chr3L:93257951..93257975 21/25 unknown
chr3S:49868722..49868746 21/25 unknown
Publications
First: Syndecan-4 regulates non-canonical Wnt signalling and is essential for convergent and extension movements in Xenopus embryos., Nat Cell Biol 2006  
Most recent: PDGF-A suppresses contact inhibition during directional collective cell migration., Development 2018                      
View All Papers