Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250278

Morpholino Name: sdc4 MO1
Synonyms: Sdc4, syn4 MO1, xSyn4.1 MO
mRNA Target: sdc4

Morpholino Type: Translation Blocking()
Sequence:
5' GCACAAACAGCAGGGTCGGACTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' ATGAGTCCGACCCTGATGTTTGTGC 3' ||||||||||||||| ||||||||| 3' TACTCAGGCTGGGACGACAAACACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold13265:1064759..1064783 24/25 Antisense target sdc4.S
Scaffold268638:183533..183557 21/25 unknown
Scaffold81122:832098..832122 21/25 unknown
Scaffold9266:1921600..1921624 21/25 unknown
Publications
First: Syndecan-4 regulates non-canonical Wnt signalling and is essential for convergent and extension movements in Xenopus embryos. [Nat Cell Biol 2006]
Most recent: PDGF-A suppresses contact inhibition during directional collective cell migration. [Development 2018]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556