Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250279

Morpholino Name: sdc4 MO2
Synonyms: Sdc4, syn4 MO2, xSyn4.2 MO
mRNA Target: sdc4

Morpholino Type: Translation Blocking()
Sequence:
5' CTAAAAGCAGCAGGAGGCGATTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGAATCGCCTCCTGCTGCTTTTAG 3' ||||||||||||||||||||||||| 3' TACTTAGCGGAGGACGACGAAAATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold75417:3959919-3959943 25/25 Antisense target sdc4.L
tropicalis 7.1 scaffold_1:94717983-94718007 21/25 Sense off-target tmem2
Publications
First: Syndecan-4 regulates non-canonical Wnt signalling and is essential for convergent and extension movements in Xenopus embryos. [Nat Cell Biol 2006]
Most recent: Angiopoietin-like 4 Is a Wnt Signaling Antagonist that Promotes LRP6 Turnover. [Dev Cell 2017]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556