Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250280

Morpholino Name: sdcbp MO1
Synonyms: Xsyntenin-a
mRNA Target: sdcbp

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAGACCTGCCGACAGTCGAATAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold230826:3980399..3980423 22/25 Antisense off-target Xelaev16030009m
Scaffold58038:2615853..2615877 21/25 unknown
Publications
First: The postsynaptic density 95/disc-large/zona occludens protein syntenin directly interacts with frizzled 7 and supports noncanonical Wnt signaling., Mol Biol Cell 2008                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556